View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4661_high_19 (Length: 282)

Name: NF4661_high_19
Description: NF4661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4661_high_19
NF4661_high_19
[»] chr3 (2 HSPs)
chr3 (19-272)||(49993980-49994233)
chr3 (128-193)||(25800028-25800093)
[»] chr1 (1 HSPs)
chr1 (122-189)||(1874599-1874666)


Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 272
Target Start/End: Original strand, 49993980 - 49994233
Alignment:
19 ctgaactggcataggaacaccgtacatggcaccggtgaggaagttatagaagccggtgaaaatcaaagtggtgccaaggttgaggtttttggaaagggtg 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49993980 ctgaactggcataggaacaccgtacatggcaccggtgaggaagttatagaagccggtgaaaatcaaagtggtgccaaggttgaggtttttggaaagggtg 49994079  T
119 agcgaaagtactattggtatgtatgtgccaaggtcacccatggctccattgagttcagacaatgttgaatggaaatttaagttgnnnnnnnnnnnnngta 218  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||             |||    
49994080 agtgaaagtactattggtatgtatgtgccaaggtcacccatggctccattgagttcagataatgttgaatggaaatttaagttgttttttactttttgta 49994179  T
219 tggtggtgagtcttgtgggagtggtggtgggaagagtttgggggtttgatgatg 272  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49994180 tggtggtgagtcttgtgggagtggtggtgggaagagtttgggggtttgatgatg 49994233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 128 - 193
Target Start/End: Original strand, 25800028 - 25800093
Alignment:
128 actattggtatgtatgtgccaaggtcacccatggctccattgagttcagacaatgttgaatggaaa 193  Q
    ||||| |||||||| |||||||||||||||||||| ||||| | ||||| | || |||||||||||    
25800028 actatgggtatgtaggtgccaaggtcacccatggcaccatttaattcagcccattttgaatggaaa 25800093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 122 - 189
Target Start/End: Complemental strand, 1874666 - 1874599
Alignment:
122 gaaagtactattggtatgtatgtgccaaggtcacccatggctccattgagttcagacaatgttgaatg 189  Q
    ||||| |||||||||||||| |||||||||||||||||||| ||||| ||||||| | || |||||||    
1874666 gaaagaactattggtatgtaggtgccaaggtcacccatggcaccatttagttcagcccattttgaatg 1874599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University