View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4661_high_23 (Length: 251)
Name: NF4661_high_23
Description: NF4661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4661_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 5 - 245
Target Start/End: Original strand, 9148789 - 9149041
Alignment:
| Q |
5 |
taacaatgagatgaagttttaggcatttggggaggcaagtgtgtgctttttgtatcattgcattgcatttctaactgaaaaagacaatgttgaaagttat |
104 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9148789 |
taacaaggaaatgaagttttaggcatttggggaggcaagtgtgtgctttttgtatcattgcattgcatttctaactgaaaaagacaatgttgaaagttat |
9148888 |
T |
 |
| Q |
105 |
ttatttccttcgaggtatatatgccttgataccagggagatgctgcaacttaagtccaacatcccaagataacgttggcttgcttcttaagtcattaaac |
204 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9148889 |
ttatttccttcaaggtatatatgccttgataccagggagatgctgcaacttaagtccaacatcccaagataacgttggcttgcttcttaagtcattaaac |
9148988 |
T |
 |
| Q |
205 |
cta------------ctttccaagcaatatcatgttctttttgggctgcttta |
245 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9148989 |
ctactttccagcttcctttccaagcaatatcatgttctttttgggctgcttta |
9149041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University