View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4661_high_29 (Length: 238)
Name: NF4661_high_29
Description: NF4661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4661_high_29 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 43 - 238
Target Start/End: Complemental strand, 43895859 - 43895664
Alignment:
| Q |
43 |
acaagcaccatcaatcatttaatcatcaccattttgtttatttattttgtccgtgtctctccttcaatgccctatatgtgtgtttgatgacattgaattt |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43895859 |
acaagcaccatcaatcatttaatcatcaccattttgtttatttattttgtccgtgtctctccttcaatgccctatatgtgtgtttgatgacattgaattc |
43895760 |
T |
 |
| Q |
143 |
gaaaatattgcccatgaaatcaataaaaattggttccactgagtaattattatgtgttttctctttttcctattagtattaacctgaaccattgtt |
238 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43895759 |
gaaaatattgcccatgaaatcattaaaaattggttccactgagtaattattatgtgttttctctttttcctattagtattaacctgaaccattgtt |
43895664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University