View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4661_high_34 (Length: 224)
Name: NF4661_high_34
Description: NF4661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4661_high_34 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 137 - 224
Target Start/End: Original strand, 2446410 - 2446497
Alignment:
| Q |
137 |
gtttataatgatataacggaaaagagaaaatggtgtagcgtgtgcgtggaaattggaatgattgaaagagtaaaatatgcgtaatgta |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2446410 |
gtttataatgatataacggaaaagagaaaatggtgtagcgtgtgcgtggaaattggaatgattgaaagagtaaaatatgagtaatgta |
2446497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 7 - 64
Target Start/End: Original strand, 2446280 - 2446337
Alignment:
| Q |
7 |
catacttcagattacaatacagattgttcgcacacaaaaaatatagctgactttagag |
64 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2446280 |
catacttcagattacaatacagattgttcacacacaaaaaatatagctgactttagag |
2446337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University