View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4661_high_34 (Length: 224)

Name: NF4661_high_34
Description: NF4661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4661_high_34
NF4661_high_34
[»] chr8 (2 HSPs)
chr8 (137-224)||(2446410-2446497)
chr8 (7-64)||(2446280-2446337)


Alignment Details
Target: chr8 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 137 - 224
Target Start/End: Original strand, 2446410 - 2446497
Alignment:
137 gtttataatgatataacggaaaagagaaaatggtgtagcgtgtgcgtggaaattggaatgattgaaagagtaaaatatgcgtaatgta 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
2446410 gtttataatgatataacggaaaagagaaaatggtgtagcgtgtgcgtggaaattggaatgattgaaagagtaaaatatgagtaatgta 2446497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 7 - 64
Target Start/End: Original strand, 2446280 - 2446337
Alignment:
7 catacttcagattacaatacagattgttcgcacacaaaaaatatagctgactttagag 64  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
2446280 catacttcagattacaatacagattgttcacacacaaaaaatatagctgactttagag 2446337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University