View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4661_low_11 (Length: 364)
Name: NF4661_low_11
Description: NF4661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4661_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 155 - 355
Target Start/End: Original strand, 35292795 - 35292995
Alignment:
| Q |
155 |
acacatatcactagtgctcattcatcacctcatcacactacatccagttactcaccttctcatcatacttctcatgataacaatctgccaccaggaccca |
254 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35292795 |
acacatatcactagtgctcatttatcacctcatcacactacatccagttactcaccttctcatcatgcttctcatgataacaatctgccaccaggaccca |
35292894 |
T |
|
| Q |
255 |
tttttaatcctacaccaattaccactatttcaccctcctcttctggtgttatctcttcaccttctcagtcacacagcaacaacactgtcagtcagtataa |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35292895 |
tttttaatcctacaccaattaccactatttcaccctcctcttctggtgttatctcttcaccttctcagtcacacagcaacaacactgtcagtcagcataa |
35292994 |
T |
|
| Q |
355 |
t |
355 |
Q |
| |
|
| |
|
|
| T |
35292995 |
t |
35292995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 19 - 157
Target Start/End: Original strand, 35292618 - 35292756
Alignment:
| Q |
19 |
tcatcagccttccactacttctgacaccagttcatctttcaccacttttcccatcattaagccacctacaaataacacatcctctacaactgatgattca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35292618 |
tcatcagccttccactacttctgacaccagttcatctttcaccacttttcccatcattaagccacctacaaataacacatcctctacaactgatgattca |
35292717 |
T |
|
| Q |
119 |
tctctaccttcatctttaccttctggttctactcccaca |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35292718 |
tctctaccttcatctttaccttctggttctactcccaca |
35292756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University