View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4661_low_13 (Length: 325)
Name: NF4661_low_13
Description: NF4661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4661_low_13 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 19 - 325
Target Start/End: Original strand, 55369868 - 55370181
Alignment:
| Q |
19 |
gttaaggccatggttttgcaagaatccttttgcaactacccttactttatgatttgcaatggagccatcgagctagttgggagggattcagcttatggtc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
55369868 |
gttaaggccatggttttgcaagaatccttttgcaactacccttactttatgatttgcaatggagccatcgagctagttggg-ggtattcagcttatggtc |
55369966 |
T |
 |
| Q |
119 |
gacaac--------aaccgaccttgctgaacattccatagctctagggagatgcaagcacatagaggtcaagtttcacttccttagagatcaagtcaaca |
210 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55369967 |
gacaacaaatcaacaaccgaccttgctgaacattccatagctcttgggagatgcaagcacattgaggtcaagtttcacttccttagagatcaagtcaaca |
55370066 |
T |
 |
| Q |
211 |
cgggaaggatcactctaagctactgtaagactgatggtcaagctgcagatgttcttaccaagccattgaagatagaaaagttcaaagacatgaggaagat |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55370067 |
cgggaaggatcactctaagctactgtaagactgatgatcaagctgcagatgttcttaccaagccattgaagatagaaaagttcaaagacatgaggaagat |
55370166 |
T |
 |
| Q |
311 |
gcatgtgattagcct |
325 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
55370167 |
gcatgtgattagcct |
55370181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University