View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4661_low_14 (Length: 318)
Name: NF4661_low_14
Description: NF4661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4661_low_14 |
 |  |
|
| [»] scaffold0155 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 19 - 299
Target Start/End: Complemental strand, 42394500 - 42394220
Alignment:
| Q |
19 |
ttttcgccaaccgtgatccccctgccgccggaaaagcagctacatacggtggctcagatatatcatggagcccgtacggaccacagtggcggatgctgag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42394500 |
ttttcgccaaccgtgatccccctgccgccggaaaagcagctacatatggtggctcagatatatcatggagcccgtacggaccacagtggcggatgctgag |
42394401 |
T |
 |
| Q |
119 |
gaaagtttgtgtggtgaagatgcttagcaataaaagtcttgattcagtctacgaactccgccgtggtgaggttcggaaaatggtagagtatattcacaac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42394400 |
gaaagtttgtgtggtgaagatgcttagcaataaaagtcttgattcagtctacgaactccgccgtggtgaggttcggaaaatggtagagtatattcacaac |
42394301 |
T |
 |
| Q |
219 |
tgtgccggatcaacggtgaatgttggggagcaagtgtttttgacggtgttaaacgtgattactaatatgatgtggggtgcg |
299 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42394300 |
tgtgccggatcaacggtgagtgttggggagcaagtgtttttgacggtgttgaacgtgattactaatatgatgtggggtgcg |
42394220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 16 - 299
Target Start/End: Complemental strand, 42378588 - 42378305
Alignment:
| Q |
16 |
cagttttcgccaaccgtgatccccctgccgccggaaaagcagctacatacggtggctcagatatatcatggagcccgtacggaccacagtggcggatgct |
115 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | ||| || || ||||| ||| |||||| ||||| ||| ||||| ||||||||||| ||||| |
|
|
| T |
42378588 |
cagttttcgccaaccgtgacgtccctgccgccggtagagccgccacttacggcggcaacgatatagtatggaccccctacggtccacagtggcgtatgct |
42378489 |
T |
 |
| Q |
116 |
gaggaaagtttgtgtggtgaagatgcttagcaataaaagtcttgattcagtctacgaactccgccgtggtgaggttcggaaaatggtagagtatattcac |
215 |
Q |
| |
|
||| ||| | ||||| |||||||||||||| || | || |||||| || || ||||| ||||| || |||||||||||||||| ||| | ||||||||| |
|
|
| T |
42378488 |
gagaaaaatctgtgtcgtgaagatgcttagtaacacaactcttgactccgtttacgagctccgacgaggtgaggttcggaaaacggtcgggtatattcat |
42378389 |
T |
 |
| Q |
216 |
aactgtgccggatcaacggtgaatgttggggagcaagtgtttttgacggtgttaaacgtgattactaatatgatgtggggtgcg |
299 |
Q |
| |
|
| | | || ||||||||||||||||| ||||| || ||||| |||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
42378388 |
gatcgggtagggtcaacggtgaatgttggtgagcaggtttttttaacggtgttgaatgtgattacgaatatgatgtggggtgcg |
42378305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0155 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: scaffold0155
Description:
Target: scaffold0155; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 18 - 185
Target Start/End: Complemental strand, 391 - 224
Alignment:
| Q |
18 |
gttttcgccaaccgtgatccccctgccgccggaaaagcagctacatacggtggctcagatatatcatggagcccgtacggaccacagtggcggatgctga |
117 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
391 |
gttttcaccaaccgtgatccccctgctgccggaaaagcagctacatacggtggctcagatatatcatggagcccgtacggaccacagtggtggatgctga |
292 |
T |
 |
| Q |
118 |
ggaaagtttgtgtggtgaagatgcttagcaataaaagtcttgattcagtctacgaactccgccgtggt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
291 |
ggaaagtttgtgtggtgaagatgcttagcaataaaagtcttgattcagtgtatgaactccgccgtggt |
224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University