View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4661_low_27 (Length: 239)
Name: NF4661_low_27
Description: NF4661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4661_low_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 233
Target Start/End: Original strand, 3802180 - 3802394
Alignment:
| Q |
19 |
cctttctctttcacattttctttgaactttcagatctagaattctagccaatgcatctggtgaaaacctcttgtttgttctctcagcacaattaaattga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3802180 |
cctttctctttcacattttctttgaactttcagatctagaattctaaccaatgcatctggtgaaaacctcttgtttgttctctcgacacaattaaattga |
3802279 |
T |
|
| Q |
119 |
aacaaaatccttcatccaagtgaatacatcttgcgtttgtggaatcccccaccatcctatctttacttttcggcagtgtcccccttttagtcttcttcaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3802280 |
aacaaaatccttcatccaagtgaatacatcttgtgtttgtggaatcccccaccatcctctctttacttttcggtagtgtcccccttttagtcttcttcaa |
3802379 |
T |
|
| Q |
219 |
gatggttcttctcac |
233 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
3802380 |
gatggttcttttcac |
3802394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University