View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4661_low_36 (Length: 207)
Name: NF4661_low_36
Description: NF4661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4661_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 20 - 190
Target Start/End: Complemental strand, 42393826 - 42393656
Alignment:
| Q |
20 |
tttaactctgattcaaattaaaatttatttgagaatgctaacatgtgccctaaggcacgtgttgaagaacttaataccattgagtttgtatgaacaggac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42393826 |
tttaactctgattcaaattaaaatttatttgagaatgctaacatgtgccctaaggcgtgcgttgaagaacttaataccattgagtttgtatgaacaggac |
42393727 |
T |
 |
| Q |
120 |
atggtacttggtggatcagacacatcctccaataccgttgagtttgcaatggcagaaatgatgaacaaacc |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42393726 |
atggtacttggtggatcagacacatcctccaataccgttgaatttgcaatggcagaaatgatgaacaaacc |
42393656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 112 - 190
Target Start/End: Complemental strand, 42377182 - 42377104
Alignment:
| Q |
112 |
aacaggacatggtacttggtggatcagacacatcctccaataccgttgagtttgcaatggcagaaatgatgaacaaacc |
190 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
42377182 |
aacaggacatggtagtgggtggatcagacacatcctccaacacaattgagtttgtaatggcagaaatgatgaacaaacc |
42377104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 103 - 187
Target Start/End: Complemental strand, 42387539 - 42387455
Alignment:
| Q |
103 |
gtttgtatgaacaggacatggtacttggtggatcagacacatcctccaataccgttgagtttgcaatggcagaaatgatgaacaa |
187 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||||||||||||||| || ||||||||| ||| ||| |||||||| |||| |
|
|
| T |
42387539 |
gtttatatgaacaggacatggtagtgggtggatcagacacatcctccaacacaattgagtttgtaatagcataaatgatggacaa |
42387455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University