View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4662_high_18 (Length: 260)
Name: NF4662_high_18
Description: NF4662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4662_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 4e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 8 - 125
Target Start/End: Original strand, 19178762 - 19178877
Alignment:
| Q |
8 |
cccctcagaatgatgtggcaggctcattaatgccatgtaaacgtgctacttttgacggaatagatttatgccaagcccttatcaatgatggatttggcga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19178762 |
cccctcagaatgatgtggcaggctcattaatgccatgtaagcgtgcta--tttgacggaatagatttatgccaagcccttgccaatgatggatttggcga |
19178859 |
T |
|
| Q |
108 |
gacaattactcccgtcat |
125 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
19178860 |
gacaattactcctgtcat |
19178877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University