View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4662_high_21 (Length: 242)
Name: NF4662_high_21
Description: NF4662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4662_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 27833933 - 27833715
Alignment:
| Q |
1 |
tcttcatatttggtatgagcttataacttatattttttctctcaattttgtatctattgtattaattgaaaaagaatacaaattaaacatatcttttact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27833933 |
tcttcatatttggtatgagcttataacttatattttttctctcaattttgtatctattgtattaattgaaaaagaatacaaattaaacatatcttttact |
27833834 |
T |
 |
| Q |
101 |
tgtcatttcatattttt-----------caattagttttaccgaacattacaaattcaatcagttagcatatatgctataagcacatccgttataagcta |
189 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27833833 |
tgtcatttcatatttttcagcagttcgacaattagttttaccgaacattacaaattcaatcagttagcatatatactataagcacatccgttataagcta |
27833734 |
T |
 |
| Q |
190 |
gcatatctgttatccgtag |
208 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
27833733 |
gcatatcggttatccgtag |
27833715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University