View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4662_high_22 (Length: 238)
Name: NF4662_high_22
Description: NF4662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4662_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 10 - 235
Target Start/End: Complemental strand, 31049188 - 31048971
Alignment:
| Q |
10 |
tcgtttgtgagggagcattagcgatgaatggaatgtactcatacttgcgggaggaagtttttatgttgcaagtatgagttagaagtctctgattgttccn |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31049188 |
tcgtttgtgagggagcattagcgatgaatggaatgtactcatacttgcgggaggaagtttttatgttgcaagtatgagttagaaatctctgattgttcc- |
31049090 |
T |
 |
| Q |
110 |
nnnnnnnnnntattgaatagtatataggacgtgaattgtaaatctctctttgtttgaaaaaattaaggctgaccaaagtataagtaagatgactcgtaaa |
209 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||| ||||||||||| ||||||| |||||||||||||| |||||||| |
|
|
| T |
31049089 |
--gaaaaaaatattgaatagtatatagggcgtgaattgtaaatctctc----tttggaaaaattaaggttgaccaaggtataagtaagatg-ctcgtaaa |
31048997 |
T |
 |
| Q |
210 |
cctattctctcgaaaatttggtttaa |
235 |
Q |
| |
|
| || | |||| |||||||||||||| |
|
|
| T |
31048996 |
cttaatatctcaaaaatttggtttaa |
31048971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University