View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4662_low_14 (Length: 297)
Name: NF4662_low_14
Description: NF4662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4662_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 158 - 280
Target Start/End: Original strand, 27834276 - 27834398
Alignment:
| Q |
158 |
ctattcaaaatgatggaattataatttatttgcacatacacaatgttataatttatagttacaacaaagctaagatatttacttgctacacaagttaatt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27834276 |
ctattcaaaatgatggaattataatttatttgcacatacacaatgttataatttatagttacaataaagctaagatatttacttgctacacaagttaatt |
27834375 |
T |
|
| Q |
258 |
aactaacaaagtttgttacttat |
280 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
27834376 |
aactaacaaagtttgttacttat |
27834398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 27834135 - 27834229
Alignment:
| Q |
1 |
taaatggagcaaacaaggactcttatgactctctttagatctatcatatgtcatcttagagcaaagtggtaatttgtgctttaagaaaagataag |
95 |
Q |
| |
|
||||| ||||||||| | | ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
27834135 |
taaatagagcaaacatgaattcttatgactctctttagatctatcatatgttatcttagagcaaagtggtaatttgcgctctaagaaaagataag |
27834229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University