View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4662_low_17 (Length: 272)
Name: NF4662_low_17
Description: NF4662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4662_low_17 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 2 - 272
Target Start/End: Complemental strand, 39031007 - 39030736
Alignment:
| Q |
2 |
aagagaggatattaaactagtggcccccaannnnnnncaacaaagatatgaaggtgccgaaagaagacttggaagagacaattatacctatctttgcttt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39031007 |
aagagaggatattaaactagtggcccccaagggggggcaacaaagatatgaaggtgccgaaagaagacttggaagagacaattatacctatctttgcttt |
39030908 |
T |
|
| Q |
102 |
ctctctttctttcacgtgccctaactaagattaatgcttccattgcttttcatcttcatgccattcttaaacacttttagcaaaaagctctaagctaatt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39030907 |
ctctctttctttcacgtgccctaactaagattaatgcttccattgcttttcatcttcatgccattcttaaacacttttagcaaaaagctctaagctaatt |
39030808 |
T |
|
| Q |
202 |
atggtcattaattaagtctt--gacataaacttatcacacataggaaaaggggttggctagtggggacttttt |
272 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39030807 |
atggtcattaaataagtcttaagacataaacttatcacacata-gaaaaggggttggctagtggggacttttt |
39030736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University