View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4663_high_4 (Length: 260)
Name: NF4663_high_4
Description: NF4663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4663_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 2963923 - 2963702
Alignment:
| Q |
1 |
ttttgattttttgggagacatctcgttcaccttgtctatatctatgagtgggtggtgcaaaccacttctcttccgaggccggtagctttttgtgtggagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2963923 |
ttttgattttttgggagacatctcgttcaccttgtctatatctatgagtgggtggtgcaaaccacttctcttccgaggccggtagctttttgtgtggagg |
2963824 |
T |
|
| Q |
101 |
aggtcttgtttgcgtgccaatgagcggagtgcttaagtttgtttcgtgatcttatgtgtcttggttcttttgcggagttggcttggtccattctcccttt |
200 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2963823 |
aggtcttgtttgggtgccaatgagcagagtgcttaagtttgtttcgtgatcttatgtgtcttggttcttttgcggagttggcttggtcgattctcccttt |
2963724 |
T |
|
| Q |
201 |
ataagatttgtttctctaggtg |
222 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
2963723 |
ataagattcgtttctctaggtg |
2963702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 2943100 - 2942881
Alignment:
| Q |
1 |
ttttgattttttgggagacatc-tcgttcaccttgtctatatctatgagtgggtggtgcaaaccacttctcttccgaggccggtagctttttgtgtggag |
99 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| |||||||||||||||||||| ||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
2943100 |
ttttgattttttgggaggcatcctcgttcaccttgtcaatatctatgagtgggtggtgtaaaccacttctctgccatggccggtagctttttgtgtggag |
2943001 |
T |
|
| Q |
100 |
gaggtcttgtttgcgtgccaatgagcggagtgcttaagtttgtttcgtgatcttatgtgtcttggttcttttgcggagttggcttggtccattctccctt |
199 |
Q |
| |
|
| ||||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
2943000 |
g---tcttgtttgggtgccaatgagcggagtgcttgggtttgtttggtgatcttatgtgtcttggttctttggtggagttggcttggtccattctccctt |
2942904 |
T |
|
| Q |
200 |
tataagatttgtttctctaggtg |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2942903 |
tataagatttgtttctctaggtg |
2942881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University