View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4663_high_7 (Length: 227)
Name: NF4663_high_7
Description: NF4663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4663_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 51 - 115
Target Start/End: Original strand, 17770929 - 17770993
Alignment:
| Q |
51 |
agttgaaacaattaatgataaatggtgtctttttgagcttgtaaccttttgatttcggctgacag |
115 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17770929 |
agttgaaacaaataatgataaatggtgtctttttgagcttgtaaccttttgatttcggctgacag |
17770993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University