View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4664-Insertion-12 (Length: 142)
Name: NF4664-Insertion-12
Description: NF4664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4664-Insertion-12 |
 |  |
|
| [»] chr5 (5 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 47; Significance: 3e-18; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 96 - 142
Target Start/End: Complemental strand, 33800428 - 33800382
Alignment:
| Q |
96 |
taattgtttactttacatgttgcctcaaaacttatttttgttatgag |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33800428 |
taattgtttactttacatgttgcctcaaaacttatttttgttatgag |
33800382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 7 - 48
Target Start/End: Complemental strand, 33729388 - 33729347
Alignment:
| Q |
7 |
agaatgtttgtccaatctgtaagaagactgctctgaacattt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33729388 |
agaatgtttgtccaatctgtaagaagactgatctgaacattt |
33729347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 7 - 48
Target Start/End: Complemental strand, 33800505 - 33800464
Alignment:
| Q |
7 |
agaatgtttgtccaatctgtaagaagactgctctgaacattt |
48 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33800505 |
agaatgtttgtccaatctgtaagaacactgctctgaacattt |
33800464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 96 - 134
Target Start/End: Complemental strand, 33729293 - 33729255
Alignment:
| Q |
96 |
taattgtttactttacatgttgcctcaaaacttattttt |
134 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
33729293 |
taattgtttactttacatgttgccttaaaacttactttt |
33729255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 96 - 137
Target Start/End: Original strand, 6128465 - 6128506
Alignment:
| Q |
96 |
taattgtttactttacatgttgcctcaaaacttatttttgtt |
137 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
6128465 |
taattgtttgttttacatgttgcctcaaaacttacttttgtt |
6128506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University