View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4664_low_8 (Length: 275)
Name: NF4664_low_8
Description: NF4664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4664_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 266
Target Start/End: Original strand, 16344473 - 16344713
Alignment:
| Q |
19 |
acttatcagctttatgcctccaaggaatagtgagtgattttattaatatggtgaattaaggatggataggctagctgcaactccattggaacatgccatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16344473 |
acttatcagctttatgcctccaaggaatagtg----attttattaatatggtgcattaaggatggataggctagctgcaactccattggaacatgccatt |
16344568 |
T |
 |
| Q |
119 |
gagaattggatgaaatcattcactttggactgcagattattgtgcagattatggggaatatgaagcaagtcaaccaaaggggatccacaccaatcatctg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16344569 |
gagaattggatgaaatcattcactttggactgcag---attgtgcagattatgggaaatatgaagcaagtcaaccaaaggggatccacaccaatcatctg |
16344665 |
T |
 |
| Q |
219 |
tccaaaaattaattttatgaccatcaccaagttgccatctagaattat |
266 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
16344666 |
tccaaaaattaattttatgaccatcactaagttgccatctacaattat |
16344713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 249
Target Start/End: Original strand, 12043624 - 12043762
Alignment:
| Q |
112 |
tgccattgagaattg--gatgaaatcattcactttggactgcagattattgtgcagattatggggaatatgaagcaagtcaaccaaaggggatccacacc |
209 |
Q |
| |
|
||||||||||||||| |||| | ||||||||| | || | ||||||| ||||| |||||||||||||||| ||| |||| ||| |||| |||||||| |
|
|
| T |
12043624 |
tgccattgagaattgatgatgtagtcattcactgtagagagaagattatgatgcaggttatggggaatatgaaacaaatcaa-caagggggttccacacc |
12043722 |
T |
 |
| Q |
210 |
aatcatctgtccaaaaattaattttatgaccatcaccaag |
249 |
Q |
| |
|
|||||| ||||| || || || || || ||||||||||| |
|
|
| T |
12043723 |
aatcatgagtccagaagttgatcttttggccatcaccaag |
12043762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University