View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4665-Insertion-12 (Length: 138)
Name: NF4665-Insertion-12
Description: NF4665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4665-Insertion-12 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 2e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 2e-68
Query Start/End: Original strand, 8 - 138
Target Start/End: Complemental strand, 36675533 - 36675403
Alignment:
| Q |
8 |
tgatggtcaccacaaggaaactgtgagggtgcaccattggcaacccgtagagagtccaaaccatgcagttcatcaacgtggctaggtatggtacgggtga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36675533 |
tgatggtcaccacaaggaaactgtgagggtgcaccattggcaacccgtagagagtccaaaccatgcagttcatcaacgtggctaggtatggtacgggtga |
36675434 |
T |
 |
| Q |
108 |
gtattgttccactgatcctttcttgcatatc |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36675433 |
gtattgttccactgatcctttcttgcatatc |
36675403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 131; E-Value: 2e-68
Query Start/End: Original strand, 8 - 138
Target Start/End: Complemental strand, 36685615 - 36685485
Alignment:
| Q |
8 |
tgatggtcaccacaaggaaactgtgagggtgcaccattggcaacccgtagagagtccaaaccatgcagttcatcaacgtggctaggtatggtacgggtga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36685615 |
tgatggtcaccacaaggaaactgtgagggtgcaccattggcaacccgtagagagtccaaaccatgcagttcatcaacgtggctaggtatggtacgggtga |
36685516 |
T |
 |
| Q |
108 |
gtattgttccactgatcctttcttgcatatc |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36685515 |
gtattgttccactgatcctttcttgcatatc |
36685485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.0000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 34 - 138
Target Start/End: Original strand, 42224337 - 42224441
Alignment:
| Q |
34 |
gggtgcaccattggcaacccgtagagagtccaaaccatgcagttcatcaacgtggctaggtatggtacgggtgagtattgttccactgatcctttcttgc |
133 |
Q |
| |
|
||||||||||| |||| ||||| || ||||| ||||||||||| | | || |||||||||||| | |||||| |||| ||||| ||||||||||| | |
|
|
| T |
42224337 |
gggtgcaccataggcagaccgtatagtgtccataccatgcagttaacaagtgttgctaggtatggtgctggtgagaattgctccacagatcctttcttcc |
42224436 |
T |
 |
| Q |
134 |
atatc |
138 |
Q |
| |
|
||||| |
|
|
| T |
42224437 |
atatc |
42224441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University