View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4665_high_3 (Length: 340)
Name: NF4665_high_3
Description: NF4665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4665_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 19 - 133
Target Start/End: Complemental strand, 8498450 - 8498336
Alignment:
| Q |
19 |
acaatcggttaaagatgtgatctcttttgcttacccttgaaaatcggaacaccaaggtaattgaagggcaatgaacctttgttgaaaccaatcaagtctg |
118 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8498450 |
acaatcggttgaagatgtgatctcttttgcttacccttgaaaatcagaacaccaaggtaattgaagggcaatgaacctttgttgaaaccaatcaagtctg |
8498351 |
T |
 |
| Q |
119 |
acatgagattgatcc |
133 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
8498350 |
acatgagattgatcc |
8498336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University