View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4665_low_5 (Length: 228)
Name: NF4665_low_5
Description: NF4665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4665_low_5 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 7 - 228
Target Start/End: Original strand, 11402352 - 11402573
Alignment:
| Q |
7 |
gaaaagtcaagtgaacttcaataatattaatgaatccaatcaaatgggagaggacatggaaacttcgatcaaaagagagaacaatttcaatccaaaaggt |
106 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11402352 |
gaaaagtcaagtgaacttcaataacattaatgaatccaatcaaatgggagaggacatgaaaacttcgatcaaaagagagaacaatttcaatccaaaaggt |
11402451 |
T |
|
| Q |
107 |
ggaaacaattttggttctatcaactatatatggcaaaggaagaagttattacaaccaagagaggagaaattatgttttcaccgcgacaagtttgagcgca |
206 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11402452 |
ggaaacaattttggttctatcaattatatatggcaaaggaagaagttattacaaccaagagaggagaaattatgttttcaccgcgaaaagtttgagcgca |
11402551 |
T |
|
| Q |
207 |
aagcagacgattgaagatataa |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
11402552 |
aagcagacgattgaagatataa |
11402573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University