View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4665_low_6 (Length: 208)
Name: NF4665_low_6
Description: NF4665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4665_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 17 - 193
Target Start/End: Complemental strand, 33066904 - 33066719
Alignment:
| Q |
17 |
gaaaaactgaaccctcctcgaaactccatttcgatcacgaacaaaatcaccat---------tttcttcttcaatcaccttagatccaatccacccttta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| | |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33066904 |
gaaaaactgaaccctcctcgaaactccatttccatcaccatcaaaatcaccataaccaccattttcttcttcaatcaccttagatccaatccacccttta |
33066805 |
T |
|
| Q |
108 |
tcattcacttttctattcactttcttacccaaaaaagagctattataaccaccagatattctacttgaagaagaagctcttgaatg |
193 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33066804 |
tcattcacttttctattcacttttctacctaaaaaggagctattataaccaccagagattctacttgaagaagaagctcttgaatg |
33066719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University