View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4667-Insertion-14 (Length: 410)
Name: NF4667-Insertion-14
Description: NF4667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4667-Insertion-14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 122 - 345
Target Start/End: Complemental strand, 4717469 - 4717246
Alignment:
| Q |
122 |
ttcatatttaagttacaaaacattgaaatcgattttttaggtgggttctaacaccacacaatgaacaaactaaacctaaattaacaatctaacaacaaag |
221 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4717469 |
ttcatatttaagttccaaaacattgaaatctattttttaggtgggttctaacagcacacaatcaacaaactaaacctaaattaacaatctaacaacaaag |
4717370 |
T |
 |
| Q |
222 |
aagaaaatggaagaaattatatgaagattagattgatgaatggagatttatgcttcatgaggtgtcgggagacagaggggaagagaatttgacataattt |
321 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4717369 |
aagaaaatggaagaaattatatgaaggttagattgatgaatggagatttatgcttcatgaggtgtcgggagacagaggggaagagaatttgacataattt |
4717270 |
T |
 |
| Q |
322 |
gccgtgaacagtgcagttgcactc |
345 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
4717269 |
gccgtgaacagtgcagttgcactc |
4717246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University