View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4667-Insertion-18 (Length: 217)
Name: NF4667-Insertion-18
Description: NF4667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4667-Insertion-18 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 8 - 217
Target Start/End: Original strand, 1284629 - 1284836
Alignment:
| Q |
8 |
caatagggtggctagctaatgttaataatcatttatttagtttataatgagggtttatgctcgtgtacatatagaaatggagctcttttttaaagatttg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1284629 |
caatagggtggctagctaatgttaataaacatttatttagtttataatgagggtttatgctcgtatacatatagaaatggagctcttttttaaagatttg |
1284728 |
T |
 |
| Q |
108 |
ggggttgaacaaatatttgtgatttattattattcagtagttttgtgatcattactagtttactagtgagtgtaaggcggctgcatgcacgtgcagagtc |
207 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1284729 |
ggggttgaacaaatatttgtgatttatcattattcagtagttttgtgatcattactagtttacta--gagtgtaaggcggctgcatgcacgtgcagagtc |
1284826 |
T |
 |
| Q |
208 |
ccaccattga |
217 |
Q |
| |
|
|||||||||| |
|
|
| T |
1284827 |
ccaccattga |
1284836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University