View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4667-Insertion-21 (Length: 190)
Name: NF4667-Insertion-21
Description: NF4667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4667-Insertion-21 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 74; Significance: 3e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 3e-34
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 13743714 - 13743621
Alignment:
| Q |
8 |
gctagcatgcttcttcttcctacgtatacttgggtaattgatggtataacagaaaacaaatgaaatctcacccaaatatgtatatattgtgaat |
101 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||||||||||| |
|
|
| T |
13743714 |
gctagcatgcctcttcttcctatgtatacttgggtaattgatggtataacagaaaacatattaaatctcacccaaatgtgtatatattgtgaat |
13743621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 130 - 190
Target Start/End: Original strand, 52279516 - 52279576
Alignment:
| Q |
130 |
tatgatgtgatttcaattgtccctaagctttatatatttcttaaattctatcaatacatta |
190 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
52279516 |
tatgatgtgatgtcaattgtccctaagctttatatatttctcaaattctatcaataaatta |
52279576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 8 - 40
Target Start/End: Original strand, 52269576 - 52269608
Alignment:
| Q |
8 |
gctagcatgcttcttcttcctacgtatacttgg |
40 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
52269576 |
gctagcatgcttcttcttcctatgtatacttgg |
52269608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University