View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4667-Insertion-26 (Length: 117)
Name: NF4667-Insertion-26
Description: NF4667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4667-Insertion-26 |
 |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0057 (Bit Score: 106; Significance: 2e-53; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 8 - 117
Target Start/End: Complemental strand, 36786 - 36677
Alignment:
| Q |
8 |
tatttctccccaaatatgatgtttgtttatatctctaatgtgatagtgtgagaatcaattattagtcattatattaaaatagatggttagaacatgactg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36786 |
tatttctccccaaatatgatgtttgtttatatctctaatgtgatagtgtgagaatcaattattagtcattatattaaaatagatggttagaacgtgactg |
36687 |
T |
 |
| Q |
108 |
ttagtttcca |
117 |
Q |
| |
|
|||||||||| |
|
|
| T |
36686 |
ttagtttcca |
36677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University