View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4667_high_29 (Length: 271)
Name: NF4667_high_29
Description: NF4667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4667_high_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 13 - 248
Target Start/End: Complemental strand, 28714008 - 28713773
Alignment:
| Q |
13 |
tgacacggacacacatgcttgcaagctgcaagcattgctggtattagacattatgtgatggttgtgattctccatagaatctcatccatttttatgccta |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28714008 |
tgacactgacacacatgcttgcaagctgcaagcattgctggtattagacattatgtgatggttgtgattctccatagaatctcatccatttttatgccta |
28713909 |
T |
|
| Q |
113 |
actttttcaacatcaacctctgaactcaaacgatgattaggaagtgatcagtgtctgacaatggcacgacgccgagacatgtggttacatgcatttttat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28713908 |
actttttcaacatcaacctctgaactcaaacaatgattaggaagtgatcagtgtctgacaatggcacgacgccgagacatgtggttacatgcatttttat |
28713809 |
T |
|
| Q |
213 |
tccattttctcaaattattatcggtgttgacagtgc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28713808 |
tccattttctcaaattattatcggtgttgacagtgc |
28713773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 215 - 246
Target Start/End: Complemental strand, 18570997 - 18570966
Alignment:
| Q |
215 |
cattttctcaaattattatcggtgttgacagt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18570997 |
cattttctcaaattattatcggtgttgacagt |
18570966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 215 - 244
Target Start/End: Original strand, 18919056 - 18919085
Alignment:
| Q |
215 |
cattttctcaaattattatcggtgttgaca |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18919056 |
cattttctcaaattattatcggtgttgaca |
18919085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University