View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4667_high_34 (Length: 255)
Name: NF4667_high_34
Description: NF4667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4667_high_34 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 255
Target Start/End: Original strand, 49905043 - 49905285
Alignment:
| Q |
13 |
gagatgaatagactggtattcatcaaaatagggaattgaaagccaaaatgaaaagaacatattctcccttaaaaatgcaggggacccctaaaacagaaaa |
112 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49905043 |
gagaagaatagattggtattcatcaaaatagggaattgaaagccaaaatgaaaagaacatattctcccttaaaaatgcaggggacccctaaaacagaaaa |
49905142 |
T |
|
| Q |
113 |
gagctttggccccccactctgcaagagtaaatgatgttatgagtattnnnnnnnnnnnnnagaatatgatgacactgattctctcaccctgggacttgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49905143 |
gagctttggccccccactctgcaagagtaaatgatgttatgagtattggggggttgggggagaatatgatgacactgattctctcaccctgggacttgta |
49905242 |
T |
|
| Q |
213 |
ttgtattgtacattaacattatgcacaagttactttcctatac |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49905243 |
ttgtattgtacattaacattatgcacaagttactttcctatac |
49905285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University