View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4667_high_41 (Length: 238)
Name: NF4667_high_41
Description: NF4667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4667_high_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 19 - 217
Target Start/End: Complemental strand, 36675698 - 36675498
Alignment:
| Q |
19 |
tagatttctttgaacaattttggaagtgcttaattaaactgaaaatgcattgaannnnnnnnnnnnnnn--aggttgaagatgattgcaagttgggatca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36675698 |
tagatttctttgaacaattttggaagtgcttaattaaagtgaaaatgcattgattttttttttttttttttaggttgaagatgattgcaagttgggatcg |
36675599 |
T |
|
| Q |
117 |
gtggatgatatagcttcagctgtataccagatggtcactaggattcaacaagaggcaatgttgaattaagattcattagttttttaaccttataaattaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36675598 |
gtggatgatatagcttcagctgtataccagacggtcactaggattcaacaagaggcaatgttgaattaagattcattagttttttaaccttataaattaa |
36675499 |
T |
|
| Q |
217 |
a |
217 |
Q |
| |
|
| |
|
|
| T |
36675498 |
a |
36675498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 88 - 145
Target Start/End: Original strand, 46922592 - 46922649
Alignment:
| Q |
88 |
aggttgaagatgattgcaagttgggatcagtggatgatatagcttcagctgtatacca |
145 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||| |||||| ||||| ||||||| |
|
|
| T |
46922592 |
aggttgaagatgattgcaagcttggatcagtggatgagatagctgcagctatatacca |
46922649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University