View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4667_high_46 (Length: 236)
Name: NF4667_high_46
Description: NF4667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4667_high_46 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 19 - 236
Target Start/End: Complemental strand, 15644850 - 15644633
Alignment:
| Q |
19 |
ggagccgaaaccccgaatactgttttagggtcggtttaatcaatctttgtgaaaggacaacaaactttggattagcaaaagacttgttacaaacagcagc |
118 |
Q |
| |
|
|||||| |||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15644850 |
ggagccaaaacccggaatattgttttagggtcggtttaatcaatctttgtgaaagaacaacaaactttggattagcaaaagacttgttacaaatagcagc |
15644751 |
T |
|
| Q |
119 |
ggcagaaggtcatgatgcagcaaagtatacgctgacaatgttatacatcttttctggagatcctaaaacgtataccttaggcatttcttggttgacgaag |
218 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
15644750 |
ggcagaaggtcacgatgcagcaaagtatgcgctgacaatgttatacatcttttctggagatcctaaaacgtataccttaggcatttcttggttgactaag |
15644651 |
T |
|
| Q |
219 |
ttatggcaaacaagatgc |
236 |
Q |
| |
|
|||||| ||| ||||||| |
|
|
| T |
15644650 |
ttatggaaaaaaagatgc |
15644633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University