View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4667_high_49 (Length: 234)
Name: NF4667_high_49
Description: NF4667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4667_high_49 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 234
Target Start/End: Complemental strand, 1443953 - 1443732
Alignment:
| Q |
16 |
aatttgaccattgaaaatgataaccaaatccgtattattcctcaaatagcttctactaat---agtgaacatcattgatgatccacacatggaatttctt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1443953 |
aatttgaccattgaaaatgataaccaaatccctattattcctcaaatagcttctactaattatagtgaacatcattgatgatccacacatgggatttctt |
1443854 |
T |
 |
| Q |
113 |
gttaaccttacaaaccttcaagtttcagacataacaatggaatttaactataggtcatggtgcaaattaactcaaatgaatcaatgtttcctttgtttca |
212 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1443853 |
gttaaccatacaaaccttcaagtttcagacataacaatggaatttaactataggtcatggtgcaaattaactcaaatgaatcaatgtttcctttgtttca |
1443754 |
T |
 |
| Q |
213 |
agcatacacttcttacattata |
234 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1443753 |
agcatacacttcttacattata |
1443732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University