View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4667_high_54 (Length: 211)
Name: NF4667_high_54
Description: NF4667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4667_high_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 128 - 193
Target Start/End: Original strand, 30790947 - 30791012
Alignment:
| Q |
128 |
tagtatttctgtgttgattgtgtctaatttttacattttttcattcatggaaatacatgactattc |
193 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30790947 |
tagtgtttctgtgttgattgtgtctaatttttacattttttcattcatggaaatacatgaatattc |
30791012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 38
Target Start/End: Original strand, 43183050 - 43183083
Alignment:
| Q |
5 |
atttatgatgataatgtaaattccactgctctta |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43183050 |
atttatgatgataatgtaaattccactgctctta |
43183083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University