View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4667_low_22 (Length: 338)
Name: NF4667_low_22
Description: NF4667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4667_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 217 - 330
Target Start/End: Original strand, 7471084 - 7471197
Alignment:
| Q |
217 |
aatcacttatctctctttcttccacagcgcttttcaactcaaaatcacgattccagaatattccaaccaccattgtcatccaccttccacaatcaggtat |
316 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7471084 |
aatcacttatctctctttcttccaccgcgcttttcaactcaaaaccacgattccagaatattccaaccaccattgtcatccactttccacaatcaggtat |
7471183 |
T |
 |
| Q |
317 |
cttcactctctgct |
330 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
7471184 |
cttcactctttgct |
7471197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 104
Target Start/End: Original strand, 7470882 - 7470968
Alignment:
| Q |
19 |
ggtataagagattaagt-acacttaagattttgatatagattaaataaattagatcgnnnnnnnnnttaagagcatcaaattgaata |
104 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7470882 |
ggtataagagattaatttacacttaagattttgatatagattaaataaattagatcgaaaaaaaaattaagagcatcaaattgaata |
7470968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University