View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4667_low_34 (Length: 258)
Name: NF4667_low_34
Description: NF4667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4667_low_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 8 - 240
Target Start/End: Complemental strand, 40635115 - 40634881
Alignment:
| Q |
8 |
ttgatggaatctatcccaaatggtacgaaatgaggttgagaaacactgagtttaggtcgaacatctagttaagtctaaagcaaactttcagcaaatcatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40635115 |
ttgatggaatctatcccaaatggtacgaaatgaggttgagaaacactgagtttaggtcgaacatctagttaagtctaaagcaaactttcagcaaatcatt |
40635016 |
T |
|
| Q |
108 |
ttataaat--gtttttcgaaacacaccactttaaatccgacatccatgattgatagcaagttattttcttgagagacctaaagaaagagcctcacttact |
205 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40635015 |
ttataaatatgtttttcgaaacacaccactttaaatccgacatccatgattgatagcaagttattttcttgagagacctaaagaaagagcctcacttact |
40634916 |
T |
|
| Q |
206 |
tgacacaaaccatcaatattcccatgttttctgtg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40634915 |
tgacacaaaccatcaatattcccatgttttctgtg |
40634881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University