View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4667_low_37 (Length: 252)
Name: NF4667_low_37
Description: NF4667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4667_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 122 - 246
Target Start/End: Original strand, 5182675 - 5182798
Alignment:
| Q |
122 |
aagaacaatatagcgtgaaaatacataagctgcaaaatgtagcttatgtataaacgcacatccacttttcatacaccgccaaaacaaacagctactacat |
221 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5182675 |
aagagcaatatagcgtgaaaatacataagctgcaaaatgtagtttatgtataaacgcacatccacttttcatacaccgcc-aaacaaacagctactacat |
5182773 |
T |
|
| Q |
222 |
ctttagctcgtacaacctttgctac |
246 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
5182774 |
ctttagctcgtacaacctttgctac |
5182798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 18 - 75
Target Start/End: Original strand, 5182627 - 5182684
Alignment:
| Q |
18 |
aattgcagctgcaatgtcttccaattttatagtgtctttcccattgataagagcaata |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5182627 |
aattgcagctgcaatgtcttccaattttatagtgtctttcccattgataagagcaata |
5182684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University