View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4667_low_47 (Length: 236)
Name: NF4667_low_47
Description: NF4667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4667_low_47 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 13 - 236
Target Start/End: Complemental strand, 40108531 - 40108308
Alignment:
| Q |
13 |
tcatgttcatcaaggtaccttacaaggtcggtctaatcattgatagttgcagtgctagccatcctaactttcttttggtgaatcaaatccttgttgtctt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40108531 |
tcatgttcatcaaggtaccttacaaggtcggtctaatcattgatagttgcagtgctagccaacctaactttcttttggtgaatcaaatccttgttatctt |
40108432 |
T |
 |
| Q |
113 |
gcattacttggattatgtctctaactcacacttatcgtgaagttaaccaagtggtgcatgtctttgccgagtatggcttgcagttgcagatgcctttttc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40108431 |
gcattacttggattatgtctctaactcacacttatcgtgaagttaaccaagtggtgcatgtctttgccgagtatggcttgcagttgcagatgcctttttc |
40108332 |
T |
 |
| Q |
213 |
aaattcaaattttcatccatgcct |
236 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40108331 |
aaattcaaattttcatccatgcct |
40108308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University