View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4667_low_53 (Length: 225)
Name: NF4667_low_53
Description: NF4667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4667_low_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 4 - 207
Target Start/End: Original strand, 25108082 - 25108285
Alignment:
| Q |
4 |
tcaaaagtgtattggttgagaagccatatttgaacactgttcccagttctaccaatgattctggagcaaatagaaatttaaatgtttcatctgctagctt |
103 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25108082 |
tcaaaagtgcattggttgagaagccatttttgaacactattcccagttctaccaatgattctggagcaaatagaagtttaaatgtttcatctgctagctt |
25108181 |
T |
 |
| Q |
104 |
tgggtccaatgtttctttgggtgggtatcatatgtttaaattggttgtgcctctgtcatcaattattattttgtttaatttctattgctctttaacttct |
203 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25108182 |
tgggtccaatgtttcgttgggtgggtatcatatgtttaaactggctgtgcctctgtcatcaattattattttgtttaatttctattgctctttaacttct |
25108281 |
T |
 |
| Q |
204 |
gcag |
207 |
Q |
| |
|
|||| |
|
|
| T |
25108282 |
gcag |
25108285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University