View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4667_low_54 (Length: 220)
Name: NF4667_low_54
Description: NF4667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4667_low_54 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 16 - 207
Target Start/End: Complemental strand, 1443953 - 1443759
Alignment:
| Q |
16 |
aatttgaccattgaaaatgataaccaaatccgtattattcctcaaatagcttctactaat---agtgaacatcattgatgatccacacatggaatttctt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1443953 |
aatttgaccattgaaaatgataaccaaatccctattattcctcaaatagcttctactaattatagtgaacatcattgatgatccacacatgggatttctt |
1443854 |
T |
 |
| Q |
113 |
gttaaccttacaaaccttcaagtttcagacataacaatggaatttaactataggtcatggtgcaaattaactcaaatgaatcaatgtttcctttg |
207 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1443853 |
gttaaccatacaaaccttcaagtttcagacataacaatggaatttaactataggtcatggtgcaaattaactcaaatgaatcaatgtttcctttg |
1443759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University