View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4669-Insertion-15 (Length: 290)
Name: NF4669-Insertion-15
Description: NF4669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4669-Insertion-15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 103 - 287
Target Start/End: Original strand, 36525666 - 36525850
Alignment:
| Q |
103 |
ataggctagcgttagtatcatattgaaaggttattcaatttctgttcttatgttactatttatttttcatggagagtttattttttgacaaattcatgga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36525666 |
ataggctagcgttagtatcatattgaaaggttattcaatttctgttcttatgttactatttatttttcatggagagtttattttttgacaaattcatgga |
36525765 |
T |
|
| Q |
203 |
gagtttatattcagcacaaagtttagacaaacatattctcaaaatttacctaaagttgtgttaaactaaatcaaacctaaactat |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36525766 |
gagtttatattcagcacaaagtttagacaaacatattctcaaaatttacctaaagttgtgttaaactaaatcaaacctaaactat |
36525850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 7 - 94
Target Start/End: Original strand, 36525176 - 36525263
Alignment:
| Q |
7 |
acattgatggggaagcagaggagaatgccctggctttggagggacatgatatgaagaaagattatgcacgaagaaaatgaaaggataa |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36525176 |
acattgatggggaagctgaggagaatgccctggctttggagggacatgatatgaagaaagattatgcacgaagaaaatgaaaggataa |
36525263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University