View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4669-Insertion-5 (Length: 475)
Name: NF4669-Insertion-5
Description: NF4669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4669-Insertion-5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 2e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 84 - 226
Target Start/End: Original strand, 34809709 - 34809851
Alignment:
| Q |
84 |
ctggctgttcttttgtttagcatgctcatttattaccaggttggcacagcctatcaagacctatattttcttaggaaaaattacttatgttattttttgt |
183 |
Q |
| |
|
|||||||||||||| | ||||||| ||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34809709 |
ctggctgttcttttatctagcatgttcatttacaaccaggttggcacatcctatcaagacctatattttcttaggaaaaattacttgtgttattttttgt |
34809808 |
T |
|
| Q |
184 |
tttgatattccatgattggtttgtgggtctgttattgagcatg |
226 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34809809 |
tttgatattccatgaccggtttgtgggtctgttattgagcatg |
34809851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 34809628 - 34809690
Alignment:
| Q |
18 |
tgtttttaataagtgtcatgttgtcttactccgcattttgtttttactacacagggaacatac |
80 |
Q |
| |
|
||||| |||||| || |||||||||||||| |||||| |||||||||| |||||||||||| |
|
|
| T |
34809628 |
tgtttctaataattgctatgttgtcttactcttcattttatttttactactcagggaacatac |
34809690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 85 - 150
Target Start/End: Original strand, 28909260 - 28909325
Alignment:
| Q |
85 |
tggctgttcttttgtttagcatgctcatttattaccaggttggcacagcctatcaagacctatatt |
150 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28909260 |
tggctgttcttttgtctagcatgttcatttattaccaggttggcacagcctatcaagacctatatt |
28909325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 226 - 280
Target Start/End: Complemental strand, 37726508 - 37726454
Alignment:
| Q |
226 |
gcaaacatatgtagcatatgacataggatgattttgtaaaagatgtaagtaataa |
280 |
Q |
| |
|
|||||||||||||||| || || |||||| |||||||||| |||| ||||||||| |
|
|
| T |
37726508 |
gcaaacatatgtagcagatcacctaggataattttgtaaaggatgcaagtaataa |
37726454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University