View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4669-Insertion-7 (Length: 356)
Name: NF4669-Insertion-7
Description: NF4669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4669-Insertion-7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 323; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 8 - 349
Target Start/End: Complemental strand, 42026516 - 42026174
Alignment:
| Q |
8 |
gtcctcttcaaccacaacattatccttggaccacctccctccttccgaactactttgttatgtccactgcaccatctgtgacaccatccttgctgtatga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42026516 |
gtcctcttcaaccacaacattatccttggaccacctccctccttccgagcaactttgttatgtccactgcaccatctgtgacaccatccttgctgtatga |
42026417 |
T |
|
| Q |
108 |
aacatcactattttttctcactttccaacactaccttagctagggtttttcttctccattttcttttatgcaaatataactgattctccttcatcttttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42026416 |
aacatcactattttttctcactttccaacactaccttagctagggtttttcttctccattttcttttatgcaaatataactgattctccttcatcttttt |
42026317 |
T |
|
| Q |
208 |
tcaggtgagtgttccttgcacaagcttgttcaagaccgtgactgtgagatgcggtcattgcactaatctgcttccagt-tacatgcgtgcattacttctg |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42026316 |
tcaggtgagtgttccttgcacaagcttgttcaagaccgtgactgtgagatgcggtcattgcactaatctgcttccagtcaacatgcgtgcattacttctg |
42026217 |
T |
|
| Q |
307 |
ccatcccctaatcagtttcatttgggacactctttcttctccc |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42026216 |
ccatcccctaatcagtttcatttgggacactctttcttctccc |
42026174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 203 - 270
Target Start/End: Original strand, 8885823 - 8885890
Alignment:
| Q |
203 |
ttttttcaggtgagtgttccttgcacaagcttgttcaagaccgtgactgtgagatgcggtcattgcac |
270 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
8885823 |
ttttctcaggtgagtgttccttgcacaagtttgttcaagactgtgacagtgagatgtggtcattgcac |
8885890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University