View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4669_high_11 (Length: 233)
Name: NF4669_high_11
Description: NF4669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4669_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 9678972 - 9678758
Alignment:
| Q |
1 |
cgaagattaccaaataacaaaatcagtttcaaacgatctttatcaacggttgagattgaaaactatgtgatgtagtactagtttaggaatagtggctgca |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9678972 |
cgaagattaccaaataacaaaattagtttcaaacgatctttatcaatggttgagattgaaaactatgtgatgtagtactagtttaggaatagtggctgca |
9678873 |
T |
 |
| Q |
101 |
gaaaggacacaaaatgggattagaattaacaaattaatcttaatggataatatatgaccaaaaagtgtagtaaaaaacaaacaaaggaatagattagaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9678872 |
gaaaggacacaaaatgggattagaattaacaaattaatcttaatggataatatatgaccaaaaagtgtagtaaaaaccaaacaaaggaatagattagaca |
9678773 |
T |
 |
| Q |
201 |
ggcaacaaccatgtg |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
9678772 |
ggcaacaaccatgtg |
9678758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University