View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4669_high_9 (Length: 239)

Name: NF4669_high_9
Description: NF4669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4669_high_9
NF4669_high_9
[»] chr7 (1 HSPs)
chr7 (108-196)||(40099205-40099293)


Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 108 - 196
Target Start/End: Complemental strand, 40099293 - 40099205
Alignment:
108 tacgttgttaacatggtcacgtaataaattttaaaatgtgcataaacttactatatatatggttgaccaaaaaaattatgcggttgacc 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40099293 tacgttgttaacatggtcacgtaataaattttaaaatgtgcataaacttactatatatatggttgaccaaaaaaattatgcggttgacc 40099205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University