View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4669_low_10 (Length: 236)
Name: NF4669_low_10
Description: NF4669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4669_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 115 - 219
Target Start/End: Complemental strand, 40098838 - 40098735
Alignment:
| Q |
115 |
ttgagaactttagaaagaaaacaaaaaagttataacaggatagatttgaggtggtgggggcgtaggaaggtataagcggtagagtatatgggaatgggac |
214 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40098838 |
ttgagaactt-agaaagaaaacaaaaaagttataacaggatagatttgaggtggtgggggcgtaggaaggtataagcggtagagtatatgggaatgggac |
40098740 |
T |
 |
| Q |
215 |
caagt |
219 |
Q |
| |
|
||||| |
|
|
| T |
40098739 |
caagt |
40098735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 40098958 - 40098864
Alignment:
| Q |
1 |
ctgttattaaggatattacacccaccattgttcaaatttagccctaaaatatggtaccctttcctttctgagttgtgacacaccgatgaataaga |
95 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40098958 |
ctgttatcaaggatattacacccaccattgttcaaatttagccctaaaatatggtaccctttcctttctgagttgtgacacaccgatgaataaga |
40098864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University