View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4669_low_11 (Length: 233)

Name: NF4669_low_11
Description: NF4669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4669_low_11
NF4669_low_11
[»] chr4 (1 HSPs)
chr4 (1-215)||(9678758-9678972)


Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 9678972 - 9678758
Alignment:
1 cgaagattaccaaataacaaaatcagtttcaaacgatctttatcaacggttgagattgaaaactatgtgatgtagtactagtttaggaatagtggctgca 100  Q
    ||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
9678972 cgaagattaccaaataacaaaattagtttcaaacgatctttatcaatggttgagattgaaaactatgtgatgtagtactagtttaggaatagtggctgca 9678873  T
101 gaaaggacacaaaatgggattagaattaacaaattaatcttaatggataatatatgaccaaaaagtgtagtaaaaaacaaacaaaggaatagattagaca 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
9678872 gaaaggacacaaaatgggattagaattaacaaattaatcttaatggataatatatgaccaaaaagtgtagtaaaaaccaaacaaaggaatagattagaca 9678773  T
201 ggcaacaaccatgtg 215  Q
    |||||||||||||||    
9678772 ggcaacaaccatgtg 9678758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University