View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4669_low_12 (Length: 212)

Name: NF4669_low_12
Description: NF4669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4669_low_12
NF4669_low_12
[»] chr2 (1 HSPs)
chr2 (103-196)||(17255167-17255260)


Alignment Details
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 103 - 196
Target Start/End: Original strand, 17255167 - 17255260
Alignment:
103 ccttatacgaatcaagtaattcaagccttcatttgacttcatcggaattctttgacgaacactttctaggagtgtttttatctatggtgggtgt 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17255167 ccttatacgaatcaagtaattcaagccttcatttgacttcatcggaattctttgacgaacactttctaggagtgtttttatctatggtgggtgt 17255260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University