View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4670-Insertion-2 (Length: 712)
Name: NF4670-Insertion-2
Description: NF4670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4670-Insertion-2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 8e-97; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 8e-97
Query Start/End: Original strand, 9 - 196
Target Start/End: Complemental strand, 1333237 - 1333050
Alignment:
| Q |
9 |
atgggtcatgtgatggcttgtatttacaagatgggtaaacaatagtcacattttggtccataaaattattttgattttttatgggggtacgacggtaaca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1333237 |
atgggtcatgtgatggcttgtatttacaagatgggtaaacaatagtcacattttggtccgtaaaattattttgattttttatgggggtacgacggtaaca |
1333138 |
T |
 |
| Q |
109 |
aagccaaatttggttgtaagagtaggaagtacacctagcttctaaatataaatacatgatgcaaaacaaaactggtatctctatttag |
196 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1333137 |
aagccaaatttagttgtaagagtaggaagtacacctagcttctaaatataaatacatgatgcaaaacaaaactggtatctctatttag |
1333050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 114 - 156
Target Start/End: Complemental strand, 1341081 - 1341039
Alignment:
| Q |
114 |
aaatttggttgtaagagtaggaagtacacctagcttctaaata |
156 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1341081 |
aaatttggttgtaaaagtaggaagtacacctagcttctaaata |
1341039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University