View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4670_high_3 (Length: 249)
Name: NF4670_high_3
Description: NF4670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4670_high_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 54 - 236
Target Start/End: Original strand, 29141584 - 29141766
Alignment:
| Q |
54 |
tcccacctattggactagtcctaacaatcttagttgttgtctaaaaagggctgtgtttgagttatagtcattctgtttcggaattggaagggagatgcgg |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29141584 |
tcccacctattggactagtcctaacaatcttagttgttgtctaaaaagggctgtgtttgagttatagtcattctgtttcggaattggaagggagatgcgg |
29141683 |
T |
 |
| Q |
154 |
ttggactatagtgnnnnnnnacgctgggggagcttagatgtattggatttgaaagactgcgagaaaaaagactagatatatgt |
236 |
Q |
| |
|
||||||||||| | ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29141684 |
ttggactatagcgtttttttacgctgggggaacttagatgtattggatttgaaagactgcgagaaaaaagattagatatatgt |
29141766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 29136557 - 29136607
Alignment:
| Q |
1 |
ttacgacctggccacattaccaggagctgcaagttttgtataatctttagg |
51 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
29136557 |
ttacgacctggccacattaccagcagctacaagttttgtataatctttagg |
29136607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University