View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4672_high_14 (Length: 305)
Name: NF4672_high_14
Description: NF4672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4672_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 35 - 295
Target Start/End: Original strand, 36993960 - 36994220
Alignment:
| Q |
35 |
catacccagtgactcacagcccaaactatgccctattttgagcagccccaccagttcctgtggtgtggtgtccacccacccccaattggtgcccggcaga |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36993960 |
catacccagtgactcacagcccaaactatgccctattttgagcagccccaccagttcccgtggtgtggtgtccacccacccccaattggtgcccggcaga |
36994059 |
T |
|
| Q |
135 |
agttgcagcgttgtgttcacgcgccgcctctttatcaagctcagcctggttaaccctttcttctttcttttgggttgccatctctttttgcaaaggatca |
234 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36994060 |
agctgcagcgttgtgttcacgcgccgcctctttatcaagctcagcctggttaaccctttcttctttcttttgggttgccatctctttttgcaaaggatca |
36994159 |
T |
|
| Q |
235 |
tgtgccgtcatcttctctgtctgttaatttatagcataacttattagatattcatgttcat |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36994160 |
tgtgccgtcatcttctctgtctgttaatttatagcacaacttattagatattcatgttcat |
36994220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 41 - 264
Target Start/End: Original strand, 36988191 - 36988414
Alignment:
| Q |
41 |
cagtgactcacagcccaaactatgccctattttgagcagccccaccagttcctgtggtgtggtgtccacccacccccaattggtgcccggcagaagttgc |
140 |
Q |
| |
|
||||||||||||||||||||| | ||| |||||||||||||||||||||| | ||| |||||||||||| ||||||||||||||||| | | ||| |
|
|
| T |
36988191 |
cagtgactcacagcccaaactgtctcctcgtttgagcagccccaccagttcccgaggtatggtgtccaccctgccccaattggtgcccggtggtggctgc |
36988290 |
T |
|
| Q |
141 |
agcgttgtgttcacgcgccgcctctttatcaagctcagcctggttaaccctttcttctttcttttgggttgccatctctttttgcaaaggatcatgtgcc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36988291 |
agcgttgtgttcacgcgccgcctctttatcaagttcagcctggttaaccctttcttctttcttttgggttgccatctccttttgcaaaggatcatgtgcc |
36988390 |
T |
|
| Q |
241 |
gtcatcttctctgtctgttaattt |
264 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36988391 |
gtcatcttctctgtctgttaattt |
36988414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 145 - 257
Target Start/End: Original strand, 36998877 - 36998989
Alignment:
| Q |
145 |
ttgtgttcacgcgccgcctctttatcaagctcagcctggttaaccctttcttctttcttttgggttgccatctctttttgcaaaggatcatgtgccgtca |
244 |
Q |
| |
|
||||||||||| || ||| ||||| ||||| |||||||| | | || | |||||||| |||||||||||||||||||||| ||||||| |||| |||| |
|
|
| T |
36998877 |
ttgtgttcacgtgctgccagcttatctagctctgcctggttcatctttgcctctttcttatgggttgccatctctttttgcacaggatcacgtgctgtca |
36998976 |
T |
|
| Q |
245 |
tcttctctgtctg |
257 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
36998977 |
tcttctcagtctg |
36998989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University