View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4672_high_23 (Length: 239)
Name: NF4672_high_23
Description: NF4672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4672_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 23 - 221
Target Start/End: Original strand, 46340872 - 46341073
Alignment:
| Q |
23 |
cttacggaatatggtaaaattcccatgcaacatgactacaaatgctcaaatccacatcttttgtttaacttcctcctcttagcatctgggatactactat |
122 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||| |||| ||||||| ||||||||| ||||||||| |||||||||||| ||||||||| |
|
|
| T |
46340872 |
cttatggaatatggtaaaattcccatgccacatgactacaaaagctctgatccacaggttttgtttagcttcctccttttagcatctgggctactactat |
46340971 |
T |
 |
| Q |
123 |
atgaagaagaatatga---accaacactagcattggtatcatcacatttgtagcagaagcacaatgtatcaaacatacccattgggctttgaagcacact |
219 |
Q |
| |
|
|||||||||| |||| |||| ||| ||||||||| ||||||| |||||||| ||||||||||||||| |||| |||||||||||||||| ||||||| |
|
|
| T |
46340972 |
gtgaagaagaacatgaaccaccaccaccagcattggtgtcatcacttttgtagctgaagcacaatgtatccaacacacccattgggctttgaggcacact |
46341071 |
T |
 |
| Q |
220 |
ag |
221 |
Q |
| |
|
|| |
|
|
| T |
46341072 |
ag |
46341073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 12 - 108
Target Start/End: Complemental strand, 31295790 - 31295694
Alignment:
| Q |
12 |
gtatcattaatcttacggaatatggtaaaattcccatgcaacatgactacaaatgctcaaatccacatcttttgtttaacttcctcctcttagcatc |
108 |
Q |
| |
|
|||||| ||| |||| ||||||||||||||||||||||||||||||||||| | |||| ||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
31295790 |
gtatcaataaccttatggaatatggtaaaattcccatgcaacatgactacagaagctctaatccacatcttttgtttagcttccttctcttagcatc |
31295694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 141 - 222
Target Start/End: Complemental strand, 31295694 - 31295613
Alignment:
| Q |
141 |
caacactagcattggtatcatcacatttgtagcagaagcacaatgtatcaaacatacccattgggctttgaagcacactaga |
222 |
Q |
| |
|
|||||| ||||||| | |||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31295694 |
caacaccagcattgttgtcatcacatttgtagcggaagcgcaatgtatcaaacatacccattgggctttgaagcacactaga |
31295613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University